Primitive Segmented Trapdoor Spider

   

 

Scientific name: Liphistius sp.

Common name: Primitive segmented trapdoor spider

Location: Ecological Park, Bukit Ayer, Sungai Batu Pahat, Perlis

Features: Mesothelan spiders are a group of primitively segmented trapdoor spiders whose geographical distribution spans as far north in China and down to Southeast Asia. They solely belong to the family Liphistiidae (suborder: Mesothelae) and are known as the ‘living fossil’ due to the retainment of plesiomorphic characters including the presence of abdominal tergal plates and spinneret position at the middle of opisthosoma. These ancient morphologies resemble the spider fossil records dating back to the Carboniferous period, over 300 million years ago.

Habitat: The spiders are observed to construct burrows on the cliff sides.

Web: The web is constructed inside the burrow where it is lined on the surface of the burrow.

Distribution: Commonly distributed in Southeast Asia such as Laos, Thailand, Myanmar, Peninsular Malaysia, and the Sumatra Island of Indonesia.

DNA sequence: 619 base pairs

ATATTTGGTGTTTGATCCGCACTGATTGGAACAGCATTAAGCCTTTTAATCCGTGCAGAATTAGGACAA
CCTGGATCTCTAATTGGTGATGATCAAACATACAACGTTATTGTAACAGCCCATGCTTTCATTATAATT
TTCTTTATAGTAATACCAATCATAATTGGTGGGTTTGGAAACTGATTAGTGCCTCTTATACTTAGAGCT
CCTGATATAGCTTTCCCTCGTTTGAATAATTTAAGATTTTGACTGTTACCCCCCTCAATCACTCTCCTA
TTAATTTCATCTATAGTAGAAATAGGCTCAGGAACAGGCTGAACTATTTACCCCCCTATTGCCAGAATA
GAATTCCACCCAGGAATATCAATTGATTTCACCATTTTTTCTTTGCATCTAGCAGGAGCATCTTCTATT
TTGGGAGCAATTAACTTCATTACTACAATTATCAATATACATCCTCCAGGGATATTAATAGAACGACTC
CCGTTATTTGTTTGATCCATCTTAATTACAGCAGGACTTTTACTTTTATCTCTTCCAGTACTAGCTGGA
GCTATCACCATATTATTAACAGATCGAAATTTCAACACATCATTTTTTGACCCTTCAGGAGGAGGGA

(94.64% similarity with Liphistius yangae in GenBank)

DNA barcode:

 

Asian Hermit Spider

Scientific name: Nephilengys malabarensis

Common name: Asian hermit spider/Malabar spider

Location: Gua Kelam 1, Taman Negeri Perlis, Perlis

Features: Nephilengys malabarensis belongs to the family Nephilidae, which includes golden silk orb-weavers. These spiders are known for their striking appearance. Females are larger than males, with a body length of around 10 to 15 millimeters, while males are much smaller. They have elongated bodies and long, slender legs. Their coloration varies from pale yellow to reddish-brown or black. These spiders are primarily solitary and typically only interact with each other during mating. However, they may coexist in the same habitat without much interaction. They are not aggressive towards humans and generally avoid confrontation

Habitat: Nephilengys malabarensis is commonly found in forested areas, particularly in tropical and subtropical regions. They often inhabit the edge of forests, where they can construct their orb webs to catch prey.

Web: Like many orb-weaving spiders, N. malabarensis constructs a large, circular or oval-shaped web. This web is often suspended between vegetation or other structures in their habitat, positioned to intercept flying insects.

Distribution: It is found primarily in Asia, including countries like India, Sri Lanka, Malaysia, and Singapore.

DNA sequence: 674 base pairs

CATAAAGATATTGGAACATTATATTTAGTGTTTGGGGCTTGAGCGGCTATAGTTGGGACTGCTATGAGTG
TATTAATTCGCACGGAATTGGGTCAATCGGGAAGATTGATGGGTGATGATCAATTATATAATGTAATTGT
AACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGGGGTTTTGGTAATTGA
TTGGTTCCTTTAATGTTAGGTGCTCCTGATATGGCCTTTCCTCGAATAAATAATTTAAGATTTTGGTTGT
TACCACCCTCATTGTTTTTATTATTTGTTTCGTCAATAGTTGAGATAGGGGTAGGGGCTGGTTGAACTGT
TTATCCACCGTTAGCCTCATTAGAAGGTCATTCGGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACAT
TTAGCTGGTGCTTCATCAATTATGGGTGCTATTAATTTTATTTCTACAATTATAAATATACGATCATACG
GAATAACTATGGAGAAAGTGCCTTTATTTGTTTGATCTGTTTTAATTACTGCTATTTTATTACTTTTATC
TTTGCCTGTTTTGGCAGGTGCAATTACTATATTACTAACAGATCGAAATTTTAATACCTCATTTTTTGAT
CCATCTGGAGGGGGGGATCCTATTTTATTTCAACATTTATTTTG

(98.3% similarity with N. malabarensis in GenBank)

DNA barcode:

 

 

Daddy Long Leg Spider

Scientific name: Pholcus sp.

Common name: Daddy long leg spider

Location: Gua Kelam 1, Taman Negeri Perlis, Perlis

Features: Pholcus spiders belong to the family Pholcidae, which is part of the order Araneae (spiders). There are over 1800 described species in the Pholcidae family. They are typically small to medium-sized spiders with long, slender legs, giving them their characteristic appearance resembling daddy long-legs. Their bodies are usually pale and elongated, with a small cephalothorax (head and thorax combined) and a larger abdomen. They have eight eyes arranged in two rows. Pholcus spiders are opportunistic predators, feeding primarily on small insects and other arthropods that they capture in their webs. They are known for their voracious appetite and can consume a wide variety of prey. Pholcus spiders are known for their unusual behavior of vibrating their webs when threatened, a behavior known as "plucking." This vibration can make the spider and its web appear blurry and confusing to potential predators. They possess venom, but they are not considered medically significant to humans. Their venom is primarily used to immobilize their prey rather than for defense.

Habitat: Pholcus spiders are commonly found indoors in dark, sheltered places such as basements, cellars, caves, and other human-made structures. They are also known to inhabit outdoor environments, including tree hollows and rock crevices.

Web: Pholcus spiders construct irregular, tangled webs known as "cobwebs" to capture prey. These webs are not as organized as those of orb-weaving spiders but are still effective in ensnaring insects. Pholcus spiders often hang upside down in the center of their webs, waiting for prey to become trapped.

Distribution: World wide.

DNA sequence: 628 base pairs

GAGCAGCGATGGTTGGTACGGCGTTAAGAGTTATTATTCGTATTGAATTGGGACAGGGTGGAAGTTTTTT
AGGGGACGATCATTTGTATAATGTAGTGGTTACAGCTCATGCTTTAGTTATGATTTTTTTTATAGTGATG
CCTATTTTGATTGGAGGATTTGGTAATTGGTTAGTGCCATTAATGTTAGGGGCTCCTGATATAGCTTTTC
CTCGGATAAATAACCTAAGATTTTGGCTTTTACCACCGTCTATATTATTGTTGGTTTTGTCGGGGCTTGT
TGAGACAGGGGTGGGTGCTGGATGAACTATTTATCCTCCGCTATCTTCGGGGGTAGGGCATTCTGGGGTT
TCTATGGATTTTGCTATTTTTTCTTTACATTTGGCGGGTGCTTCTTCTATTATGGGAGCTATTAATTTTA
TCTCTACTATTATTAATATGCGGTTGGTAGGGGTTGGGATAGAGAAAGTCAATTTATTTGTTTGATCCGT
ATTAATTACAGCAGTTTTGTTGTTATTGTCTTTGCCAGTATTGGCTGGGGCTATTACGATATTGTTGAGT
GATCGCAATTTTAATACTGCGTTTTTTGATCCAGCGGGGGGGGGGGATCCTATTCTTTTTCAACATTT

(91.4% similarity with P. kuhapimuk in GenBank)

DNA barcode:

 

Long-Jawed Orbweaver

 

Scientific name: Orsinome vethi

Common name: Long-jawed orbweaver

Location: Gua Kelam 1, Taman Negeri Perlis, Perlis

Features: Orsinome vethi is classified under the family Araneidae, which includes orb-weaver spiders. It is a relatively lesser-known species within this family. As an orb-weaver spider, O. vethi likely has a rounded abdomen and a relatively small cephalothorax (head and thorax combined). It may have distinctive markings or coloration, but specific details about its appearance may vary based on its habitat and geographical location. Orb-weaving spiders like O. vethi are typically solitary creatures, only interacting with other spiders during mating. They are not aggressive towards humans and generally avoid confrontation

Habitat: O. vethi is believed to inhabit forested areas or other vegetated habitats, where it can construct its orb-shaped webs to catch prey. These spiders are typically found in tropical or subtropical regions. The spiders in Gua Kelam 1 construct web in the cave.

Web: As a member of the orb-weaving family Araneidae, it constructs vertical or horizontal orb-shaped webs similar to those of other orb-weaving spiders.

Distribution: Orsinome vethi is a relatively lesser-known species of spider, and detailed information about its distribution may be limited. However, it is believed to be native to certain regions in Asia, particularly in tropical or subtropical areas.

DNA sequence: 675 base pairs

CATAAAGATATTGGAACATTATATTTTATTTTTGGGGCTTGGGCTGCTATGGTAGGTACTGCAATAAGAG
TTTTGATCCGAATTGAATTAGGGCAACCTGGAAGATTTTTGGGAGATGACCAGCTTTATAATGTGGTAGT
AACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATACCTATTTTAATTGGGGGGTTTGGAAATTGA
TTAGTTCCTTTAATATTAGGGGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTGT
TACCCCCCTCTTTATTCCTTTTGATTATTTCATCAATAGTTGATATAGGGGTGGGAGCTGGTTGAACTGT
TTATCCTCCTTTAGCTTCTTTGGAAGGGCATCCAGGATGTTCAATAGATTTCGCTATTTTTTCTCTTCAT
TTAGCTGGGGCTTCTTCTATTATAGGAGCTATTAACTTTATTTCTACCGTTTTTAATATGCGAGTGGTAG
GAATAAGAATAGAAAGGGTTCCTCTTTTTGTATGGTCTGTTTTAATTACTGCTGTTTTGTTGTTACTATC
TTTACCTGTGTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGAT
CCTAGTGGGGGAGGAGATCCTGTGCTTTTTCAGCATTTATTTTGA

(100.0% similarity with O. vethi in GenBank)

DNA barcode:

 

Brown Sailor Spider

 

Scientific name: Neoscona nautica

Common name: Brown sailor spider

Location: UniCITI Alam Campus, Padang Besar, Perlis

Features: Neoscona nautica, commonly known as the brown sailor orb-weaver, is a species of spider belonging to the family Araneidae. It belongs to the genus Neoscona, which is known for its orb-weaving spiders. These spiders are widely distributed across the world. Neoscona nautica typically has a body length ranging from 5 to 9 mm in females and 4 to 6 mm in males. They have a round abdomen and a varying coloration, often with patterns of brown, gray, and white. It plays a role in controlling insect populations in its habitat. By preying on flying insects, they help regulate insect populations, which can have cascading effects on the ecosystem.

Habitat: Primarily found in tropical and subtropical regions, particularly in coastal areas. It often inhabits forests, mangroves, gardens, and urban areas.

Web: Neoscona nautica constructs orb-shaped webs, which they use to capture prey. These webs are made of sticky silk threads arranged in a spiral pattern. The spider typically waits at the center or near the edge of the web for prey to become ensnared.

Distribution: Commonly found in Southeast Asia, including countries like India, Sri Lanka, Myanmar, Thailand, Malaysia, and Indonesia.

DNA sequence: 586 base pairs

ATGATAGGAACAGCTATAAGAGTATTAATTCGAATTGAATTAGGTCAACCTGGAAGATTTATAGGTGATG
ATCAATTATATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTTT
AATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCATTTCCTCGAATA
AATAATTTAAGATTTTGATTATTGCCACCTTCATTATTTTTATTAATTATTTCTTCATTAGTAGAAATAG
GAGTAGGGGCAGGATGAACAGTATATCCACCTTTAGCTGGATTAGAAGGTCATGCTGGTAGATCTGTAGA
TTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCAATTATAGGAGCTATTAATTTTATTTCAACA
ATTATTAATATACGATTTTATGAAATAACTATAGAAAAGGTTCCTTTATTTGTATGATCTGTATTAATTA
CAGCGGTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAA
TTTTAATACTTCATTTTTTGACCCTC

(99.0% similarity with N. nautica in GenBank)

DNA barcode:

 

 

 

Cellar Spider

 

Scientific name: Crossopriza lyoni

Common name: Common cellar spider

Location: UniCITI Alam Campus, Padang Besar, Perlis

Features: Crossopriza lyoni belongs to the order Araneae (spiders) and the family Pholcidae (cellar spiders). It was first described by the British arachnologist George Albert Boulenger in 1909. Adult Crossopriza lyoni spiders typically have a body length of around 5-8 mm, with long, slender legs extending their overall size. They are usually light brown or greyish in color. Like other members of the Pholcidae family, they have elongated bodies and small, globular abdomens. Crossopriza lyoni is primarily insectivorous, preying on small arthropods that become trapped in its web. They are known to feed on a variety of insects, including flies, mosquitoes, and other spiders. Crossopriza lyoni is a nocturnal species, meaning they are most active during the night. During the day, they usually remain hidden in their webs or in other secluded locations, such as cracks in walls or behind furniture. It plays a role in controlling insect populations, particularly in human habitations where it preys on common household pests. Crossopriza lyoni is not considered medically significant to humans. While they possess venom to subdue their prey, their venom is not potent enough to cause harm to humans beyond mild irritation at the site of a bite, similar to a bee sting.

Habitat:  Commonly found in human habitations, particularly in homes, sheds, and other man-made structures. They often reside in corners or dark, sheltered areas, where they construct irregular webs.

Web: These spiders build tangled, irregular webs, typically in corners or crevices. The webs are not neatly organized like those of orb-weaving spiders but serve to ensnare prey that comes into contact with them.

Distribution: Native to regions in Africa, including South Africa, Zimbabwe, and Botswana. However, it has also been introduced to other parts of the world, including Australia, where it is considered an invasive species.

DNA sequence: 650 base pairs

TTGGAGCTTGAGCTGCGATAGTGGGTACTGCTTTGAGAGTTTTGATTCGGGTGGAGTTAGGGCAAGTGGG
TAGTTTATTAGGTGATGATCATTTATATAATGTGATTGTGACAGCTCATGCTTTAGTTATGATTTTTTTT
ATAGTTATACCTATTCTTATTGGGGGGTTTGGGAATTGATTAGTTCCTTTGATATTAGGATCTCCTGATA
TGGCGTTTCCTCGAATAAATAATTTGAGATTTTGGCTTCTTCCTCCATCATTAATATTATTAGTGATATC
AGGTATAGCGGAAACAGGAGTGGGAGCGGGATGGACTATTTATCCTCCATTGTCGTCTACTGTTGGGCAT
AGTGGAGTGTCTATAGATTTTGCTATTTTTTCTTTGCATTTGGCAGGGGCTTCTTCTATTATAGGAGCTA
TTAATTTTATTTCTACTGTAATTAATATACGTTTAGGTGGAGTAAGAATGGAAAAGGTAAGATTATTTGT
GTGATCTGTATTAATTACGGCTGTTTTATTGTTGTTATCTCTTCCTGTATTAACAGGGGCTATTACTATA
TTATTGACAGATCGTAATTTTAATACTGCTTTTTTTGACCCAGCGGGAGGTGGAGATCCTATTTTATTTC
AACATTTATTTTGATTTTTT

(99.69% similarity with C. lyoni in GenBank)

DNA barcode:

 

Golden Orb Weaver

 

Scientific name: Nephila pilipes

Common name: Giant golden orb weaver

Location: Taman Herba, Perlis

Features: It belongs to the family of Nephilidae. As the name suggests, Nephila pilipes is large, with females typically being much larger than males. Females can have a body length of up to 30-50 mm, while males are much smaller, usually around 5-6 mm. The body of Nephila pilipes varies in color from yellowish-brown to reddish-brown, often with distinct markings. Their legs are typically banded or striped with yellow and black. The abdomen of Nephila pilipes is large and rounded, often with patterns or markings that help camouflage it against the surrounding vegetation. These spiders have long, slender legs which are often banded or striped. The legs are covered in fine hairs and spines, which help in sensing vibrations and capturing prey in their webs. There is a significant size difference between males and females, with females being much larger. Additionally, males often have more elongated bodies and longer legs compared to females.

Habitat:  This species often inhabits forest edge habitats, where there is a transition between dense forest and more open areas. They can be found in both primary and secondary forests, as well as forest clearings and disturbed areas near forests. While Nephila pilipes is primarily found in lowland areas, it can occur at varying altitudes depending on the local climate and habitat conditions. In some regions, they may be found in mountainous areas up to certain elevations. It may also inhabit human-altered environments, such as gardens, parks, and agricultural areas. They are sometimes found near human dwellings, particularly in rural areas where there is abundant vegetation.

Web: Nephila pilipes constructs large, complex orb webs made of silk coated in golden pgiment. These webs can span several feet in diameter and are usually positioned in open spaces such as forests, gardens, or near human structures where prey is abundant.

Distribution: Asia, Australia, and various Pacific islands

COI gene sequence:  583 base pairs 

AGGAACTGCTATAAGAGTTTTGATTCGGATTGAATTGGGTCAAGTTGGAAGATTATTAGGAGATGATCAG
TTATATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATACCTATTTTAATTG
GGGGTTTTGGTAATTGATTGGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGCATAAATAA
TTTAAGATTTTGATTATTACCCCCTTCATTATTTTTATTATTTATTTCATCAATAGTAGAAATAGGTGTA
GGTGCAGGATGAACTGTATATCCTCCATTAGCTTCTTTAGAAGGCCATGCTGGAAGATCTGTAGATTTTG
CTATTTTTTCTTTACATTTAGCGGGTGCTTCTTCAATTATAGGGGCTATTAACTTTATTTCAACAATTTT
AAATATGCGATCATATGGAATATCTATAGAGAAAGTTCCTTTATTTGTATGATCTGTATTGATTACTGCT
GTATTACTTTTACTTTCATTACCAGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTTA
ATACTTCATTTTTTGACCCTTC

(99.0% similarity with N. pilipes in GenBank)

DNA barcode: