Daddy Long Leg Spider

Scientific name: Pholcus sp.

Common name: Daddy long leg spider

Location: Gua Kelam 1, Taman Negeri Perlis, Perlis

Features: Pholcus spiders belong to the family Pholcidae, which is part of the order Araneae (spiders). There are over 1800 described species in the Pholcidae family. They are typically small to medium-sized spiders with long, slender legs, giving them their characteristic appearance resembling daddy long-legs. Their bodies are usually pale and elongated, with a small cephalothorax (head and thorax combined) and a larger abdomen. They have eight eyes arranged in two rows. Pholcus spiders are opportunistic predators, feeding primarily on small insects and other arthropods that they capture in their webs. They are known for their voracious appetite and can consume a wide variety of prey. Pholcus spiders are known for their unusual behavior of vibrating their webs when threatened, a behavior known as "plucking." This vibration can make the spider and its web appear blurry and confusing to potential predators. They possess venom, but they are not considered medically significant to humans. Their venom is primarily used to immobilize their prey rather than for defense.

Habitat: Pholcus spiders are commonly found indoors in dark, sheltered places such as basements, cellars, caves, and other human-made structures. They are also known to inhabit outdoor environments, including tree hollows and rock crevices.

Web: Pholcus spiders construct irregular, tangled webs known as "cobwebs" to capture prey. These webs are not as organized as those of orb-weaving spiders but are still effective in ensnaring insects. Pholcus spiders often hang upside down in the center of their webs, waiting for prey to become trapped.

Distribution: World wide.

DNA sequence: 628 base pairs

GAGCAGCGATGGTTGGTACGGCGTTAAGAGTTATTATTCGTATTGAATTGGGACAGGGTGGAAGTTTTTT
AGGGGACGATCATTTGTATAATGTAGTGGTTACAGCTCATGCTTTAGTTATGATTTTTTTTATAGTGATG
CCTATTTTGATTGGAGGATTTGGTAATTGGTTAGTGCCATTAATGTTAGGGGCTCCTGATATAGCTTTTC
CTCGGATAAATAACCTAAGATTTTGGCTTTTACCACCGTCTATATTATTGTTGGTTTTGTCGGGGCTTGT
TGAGACAGGGGTGGGTGCTGGATGAACTATTTATCCTCCGCTATCTTCGGGGGTAGGGCATTCTGGGGTT
TCTATGGATTTTGCTATTTTTTCTTTACATTTGGCGGGTGCTTCTTCTATTATGGGAGCTATTAATTTTA
TCTCTACTATTATTAATATGCGGTTGGTAGGGGTTGGGATAGAGAAAGTCAATTTATTTGTTTGATCCGT
ATTAATTACAGCAGTTTTGTTGTTATTGTCTTTGCCAGTATTGGCTGGGGCTATTACGATATTGTTGAGT
GATCGCAATTTTAATACTGCGTTTTTTGATCCAGCGGGGGGGGGGGATCCTATTCTTTTTCAACATTT

(91.4% similarity with P. kuhapimuk in GenBank)

DNA barcode: