Golden Orb Weaver

 

Scientific name: Nephila pilipes

Common name: Giant golden orb weaver

Location: Taman Herba, Perlis

Features: It belongs to the family of Nephilidae. As the name suggests, Nephila pilipes is large, with females typically being much larger than males. Females can have a body length of up to 30-50 mm, while males are much smaller, usually around 5-6 mm. The body of Nephila pilipes varies in color from yellowish-brown to reddish-brown, often with distinct markings. Their legs are typically banded or striped with yellow and black. The abdomen of Nephila pilipes is large and rounded, often with patterns or markings that help camouflage it against the surrounding vegetation. These spiders have long, slender legs which are often banded or striped. The legs are covered in fine hairs and spines, which help in sensing vibrations and capturing prey in their webs. There is a significant size difference between males and females, with females being much larger. Additionally, males often have more elongated bodies and longer legs compared to females.

Habitat:  This species often inhabits forest edge habitats, where there is a transition between dense forest and more open areas. They can be found in both primary and secondary forests, as well as forest clearings and disturbed areas near forests. While Nephila pilipes is primarily found in lowland areas, it can occur at varying altitudes depending on the local climate and habitat conditions. In some regions, they may be found in mountainous areas up to certain elevations. It may also inhabit human-altered environments, such as gardens, parks, and agricultural areas. They are sometimes found near human dwellings, particularly in rural areas where there is abundant vegetation.

Web: Nephila pilipes constructs large, complex orb webs made of silk coated in golden pgiment. These webs can span several feet in diameter and are usually positioned in open spaces such as forests, gardens, or near human structures where prey is abundant.

Distribution: Asia, Australia, and various Pacific islands

COI gene sequence:  583 base pairs 

AGGAACTGCTATAAGAGTTTTGATTCGGATTGAATTGGGTCAAGTTGGAAGATTATTAGGAGATGATCAG
TTATATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATACCTATTTTAATTG
GGGGTTTTGGTAATTGATTGGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGCATAAATAA
TTTAAGATTTTGATTATTACCCCCTTCATTATTTTTATTATTTATTTCATCAATAGTAGAAATAGGTGTA
GGTGCAGGATGAACTGTATATCCTCCATTAGCTTCTTTAGAAGGCCATGCTGGAAGATCTGTAGATTTTG
CTATTTTTTCTTTACATTTAGCGGGTGCTTCTTCAATTATAGGGGCTATTAACTTTATTTCAACAATTTT
AAATATGCGATCATATGGAATATCTATAGAGAAAGTTCCTTTATTTGTATGATCTGTATTGATTACTGCT
GTATTACTTTTACTTTCATTACCAGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTTA
ATACTTCATTTTTTGACCCTTC

(99.0% similarity with N. pilipes in GenBank)

DNA barcode: