Cellar Spider

 

Scientific name: Crossopriza lyoni

Common name: Common cellar spider

Location: UniCITI Alam Campus, Padang Besar, Perlis

Features: Crossopriza lyoni belongs to the order Araneae (spiders) and the family Pholcidae (cellar spiders). It was first described by the British arachnologist George Albert Boulenger in 1909. Adult Crossopriza lyoni spiders typically have a body length of around 5-8 mm, with long, slender legs extending their overall size. They are usually light brown or greyish in color. Like other members of the Pholcidae family, they have elongated bodies and small, globular abdomens. Crossopriza lyoni is primarily insectivorous, preying on small arthropods that become trapped in its web. They are known to feed on a variety of insects, including flies, mosquitoes, and other spiders. Crossopriza lyoni is a nocturnal species, meaning they are most active during the night. During the day, they usually remain hidden in their webs or in other secluded locations, such as cracks in walls or behind furniture. It plays a role in controlling insect populations, particularly in human habitations where it preys on common household pests. Crossopriza lyoni is not considered medically significant to humans. While they possess venom to subdue their prey, their venom is not potent enough to cause harm to humans beyond mild irritation at the site of a bite, similar to a bee sting.

Habitat:  Commonly found in human habitations, particularly in homes, sheds, and other man-made structures. They often reside in corners or dark, sheltered areas, where they construct irregular webs.

Web: These spiders build tangled, irregular webs, typically in corners or crevices. The webs are not neatly organized like those of orb-weaving spiders but serve to ensnare prey that comes into contact with them.

Distribution: Native to regions in Africa, including South Africa, Zimbabwe, and Botswana. However, it has also been introduced to other parts of the world, including Australia, where it is considered an invasive species.

DNA sequence: 650 base pairs

TTGGAGCTTGAGCTGCGATAGTGGGTACTGCTTTGAGAGTTTTGATTCGGGTGGAGTTAGGGCAAGTGGG
TAGTTTATTAGGTGATGATCATTTATATAATGTGATTGTGACAGCTCATGCTTTAGTTATGATTTTTTTT
ATAGTTATACCTATTCTTATTGGGGGGTTTGGGAATTGATTAGTTCCTTTGATATTAGGATCTCCTGATA
TGGCGTTTCCTCGAATAAATAATTTGAGATTTTGGCTTCTTCCTCCATCATTAATATTATTAGTGATATC
AGGTATAGCGGAAACAGGAGTGGGAGCGGGATGGACTATTTATCCTCCATTGTCGTCTACTGTTGGGCAT
AGTGGAGTGTCTATAGATTTTGCTATTTTTTCTTTGCATTTGGCAGGGGCTTCTTCTATTATAGGAGCTA
TTAATTTTATTTCTACTGTAATTAATATACGTTTAGGTGGAGTAAGAATGGAAAAGGTAAGATTATTTGT
GTGATCTGTATTAATTACGGCTGTTTTATTGTTGTTATCTCTTCCTGTATTAACAGGGGCTATTACTATA
TTATTGACAGATCGTAATTTTAATACTGCTTTTTTTGACCCAGCGGGAGGTGGAGATCCTATTTTATTTC
AACATTTATTTTGATTTTTT

(99.69% similarity with C. lyoni in GenBank)

DNA barcode: