Scientific name: Nephilengys malabarensis
Common name: Asian hermit spider/Malabar spider
Location: Gua Kelam 1, Taman Negeri Perlis, Perlis
Features: Nephilengys malabarensis belongs to the family Nephilidae, which includes golden silk orb-weavers. These spiders are known for their striking appearance. Females are larger than males, with a body length of around 10 to 15 millimeters, while males are much smaller. They have elongated bodies and long, slender legs. Their coloration varies from pale yellow to reddish-brown or black. These spiders are primarily solitary and typically only interact with each other during mating. However, they may coexist in the same habitat without much interaction. They are not aggressive towards humans and generally avoid confrontation
Habitat: Nephilengys malabarensis is commonly found in forested areas, particularly in tropical and subtropical regions. They often inhabit the edge of forests, where they can construct their orb webs to catch prey.
Web: Like many orb-weaving spiders, N. malabarensis constructs a large, circular or oval-shaped web. This web is often suspended between vegetation or other structures in their habitat, positioned to intercept flying insects.
Distribution: It is found primarily in Asia, including countries like India, Sri Lanka, Malaysia, and Singapore.
DNA sequence: 674 base pairs
CATAAAGATATTGGAACATTATATTTAGTGTTTGGGGCTTGAGCGGCTATAGTTGGGACTGCTATGAGTG
TATTAATTCGCACGGAATTGGGTCAATCGGGAAGATTGATGGGTGATGATCAATTATATAATGTAATTGT
AACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGGGGTTTTGGTAATTGA
TTGGTTCCTTTAATGTTAGGTGCTCCTGATATGGCCTTTCCTCGAATAAATAATTTAAGATTTTGGTTGT
TACCACCCTCATTGTTTTTATTATTTGTTTCGTCAATAGTTGAGATAGGGGTAGGGGCTGGTTGAACTGT
TTATCCACCGTTAGCCTCATTAGAAGGTCATTCGGGTAGTTCAGTAGATTTTGCTATTTTTTCTTTACAT
TTAGCTGGTGCTTCATCAATTATGGGTGCTATTAATTTTATTTCTACAATTATAAATATACGATCATACG
GAATAACTATGGAGAAAGTGCCTTTATTTGTTTGATCTGTTTTAATTACTGCTATTTTATTACTTTTATC
TTTGCCTGTTTTGGCAGGTGCAATTACTATATTACTAACAGATCGAAATTTTAATACCTCATTTTTTGAT
CCATCTGGAGGGGGGGATCCTATTTTATTTCAACATTTATTTTG
(98.3% similarity with N. malabarensis in GenBank)
DNA barcode:




No comments:
Post a Comment