Monday, March 4, 2024

Primitive Segmented Trapdoor Spider

   

 

Scientific name: Liphistius sp.

Common name: Primitive segmented trapdoor spider

Location: Ecological Park, Bukit Ayer, Sungai Batu Pahat, Perlis

Features: Mesothelan spiders are a group of primitively segmented trapdoor spiders whose geographical distribution spans as far north in China and down to Southeast Asia. They solely belong to the family Liphistiidae (suborder: Mesothelae) and are known as the ‘living fossil’ due to the retainment of plesiomorphic characters including the presence of abdominal tergal plates and spinneret position at the middle of opisthosoma. These ancient morphologies resemble the spider fossil records dating back to the Carboniferous period, over 300 million years ago.

Habitat: The spiders are observed to construct burrows on the cliff sides.

Web: The web is constructed inside the burrow where it is lined on the surface of the burrow.

Distribution: Commonly distributed in Southeast Asia such as Laos, Thailand, Myanmar, Peninsular Malaysia, and the Sumatra Island of Indonesia.

DNA sequence: 619 base pairs

ATATTTGGTGTTTGATCCGCACTGATTGGAACAGCATTAAGCCTTTTAATCCGTGCAGAATTAGGACAA
CCTGGATCTCTAATTGGTGATGATCAAACATACAACGTTATTGTAACAGCCCATGCTTTCATTATAATT
TTCTTTATAGTAATACCAATCATAATTGGTGGGTTTGGAAACTGATTAGTGCCTCTTATACTTAGAGCT
CCTGATATAGCTTTCCCTCGTTTGAATAATTTAAGATTTTGACTGTTACCCCCCTCAATCACTCTCCTA
TTAATTTCATCTATAGTAGAAATAGGCTCAGGAACAGGCTGAACTATTTACCCCCCTATTGCCAGAATA
GAATTCCACCCAGGAATATCAATTGATTTCACCATTTTTTCTTTGCATCTAGCAGGAGCATCTTCTATT
TTGGGAGCAATTAACTTCATTACTACAATTATCAATATACATCCTCCAGGGATATTAATAGAACGACTC
CCGTTATTTGTTTGATCCATCTTAATTACAGCAGGACTTTTACTTTTATCTCTTCCAGTACTAGCTGGA
GCTATCACCATATTATTAACAGATCGAAATTTCAACACATCATTTTTTGACCCTTCAGGAGGAGGGA
(94.64% similarity with Liphistius yangae in GenBank)

DNA barcode:


 

No comments:

Post a Comment

Primitive Segmented Trapdoor Spider

      Scientific name: Liphistius sp. Common name: Primitive segmented trapdoor spider Location: Ecological Park, Bukit Ayer, Sungai Batu Pa...