Scientific name: Orsinome vethi
Common name: Long-jawed orbweaver
Location: Gua Kelam 1, Taman Negeri Perlis, Perlis
Features: Orsinome vethi is classified under the family Araneidae, which includes orb-weaver spiders. It is a relatively lesser-known species within this family. As an orb-weaver spider, O. vethi likely has a rounded abdomen and a relatively small cephalothorax (head and thorax combined). It may have distinctive markings or coloration, but specific details about its appearance may vary based on its habitat and geographical location. Orb-weaving spiders like O. vethi are typically solitary creatures, only interacting with other spiders during mating. They are not aggressive towards humans and generally avoid confrontation
Habitat: O. vethi is believed to inhabit forested areas or other vegetated habitats, where it can construct its orb-shaped webs to catch prey. These spiders are typically found in tropical or subtropical regions. The spiders in Gua Kelam 1 construct web in the cave.
Web: As a member of the orb-weaving family Araneidae, it constructs vertical or horizontal orb-shaped webs similar to those of other orb-weaving spiders.
Distribution: Orsinome vethi is a relatively lesser-known species of spider, and detailed information about its distribution may be limited. However, it is believed to be native to certain regions in Asia, particularly in tropical or subtropical areas.
DNA sequence: 675 base pairs
CATAAAGATATTGGAACATTATATTTTATTTTTGGGGCTTGGGCTGCTATGGTAGGTACTGCAATAAGAG
TTTTGATCCGAATTGAATTAGGGCAACCTGGAAGATTTTTGGGAGATGACCAGCTTTATAATGTGGTAGT
AACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATACCTATTTTAATTGGGGGGTTTGGAAATTGA
TTAGTTCCTTTAATATTAGGGGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTGT
TACCCCCCTCTTTATTCCTTTTGATTATTTCATCAATAGTTGATATAGGGGTGGGAGCTGGTTGAACTGT
TTATCCTCCTTTAGCTTCTTTGGAAGGGCATCCAGGATGTTCAATAGATTTCGCTATTTTTTCTCTTCAT
TTAGCTGGGGCTTCTTCTATTATAGGAGCTATTAACTTTATTTCTACCGTTTTTAATATGCGAGTGGTAG
GAATAAGAATAGAAAGGGTTCCTCTTTTTGTATGGTCTGTTTTAATTACTGCTGTTTTGTTGTTACTATC
TTTACCTGTGTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGAT
CCTAGTGGGGGAGGAGATCCTGTGCTTTTTCAGCATTTATTTTGA
(100.0% similarity with O. vethi in GenBank)
DNA barcode:





No comments:
Post a Comment