Brown Sailor Spider

 

Scientific name: Neoscona nautica

Common name: Brown sailor spider

Location: UniCITI Alam Campus, Padang Besar, Perlis

Features: Neoscona nautica, commonly known as the brown sailor orb-weaver, is a species of spider belonging to the family Araneidae. It belongs to the genus Neoscona, which is known for its orb-weaving spiders. These spiders are widely distributed across the world. Neoscona nautica typically has a body length ranging from 5 to 9 mm in females and 4 to 6 mm in males. They have a round abdomen and a varying coloration, often with patterns of brown, gray, and white. It plays a role in controlling insect populations in its habitat. By preying on flying insects, they help regulate insect populations, which can have cascading effects on the ecosystem.

Habitat: Primarily found in tropical and subtropical regions, particularly in coastal areas. It often inhabits forests, mangroves, gardens, and urban areas.

Web: Neoscona nautica constructs orb-shaped webs, which they use to capture prey. These webs are made of sticky silk threads arranged in a spiral pattern. The spider typically waits at the center or near the edge of the web for prey to become ensnared.

Distribution: Commonly found in Southeast Asia, including countries like India, Sri Lanka, Myanmar, Thailand, Malaysia, and Indonesia.

DNA sequence: 586 base pairs

ATGATAGGAACAGCTATAAGAGTATTAATTCGAATTGAATTAGGTCAACCTGGAAGATTTATAGGTGATG
ATCAATTATATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTTT
AATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCATTTCCTCGAATA
AATAATTTAAGATTTTGATTATTGCCACCTTCATTATTTTTATTAATTATTTCTTCATTAGTAGAAATAG
GAGTAGGGGCAGGATGAACAGTATATCCACCTTTAGCTGGATTAGAAGGTCATGCTGGTAGATCTGTAGA
TTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCAATTATAGGAGCTATTAATTTTATTTCAACA
ATTATTAATATACGATTTTATGAAATAACTATAGAAAAGGTTCCTTTATTTGTATGATCTGTATTAATTA
CAGCGGTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAA
TTTTAATACTTCATTTTTTGACCCTC

(99.0% similarity with N. nautica in GenBank)

DNA barcode: